ID: 1008030410_1008030425

View in Genome Browser

Spacer: 28

Left Crispr Right Crispr
Crispr ID 1008030410 1008030425
Species Human (GRCh38) Human (GRCh38)
Location 6:46688172-46688194 6:46688223-46688245
Sequence CCCTGCGGGTGTCCTTCGTGGAC TGTGGGGGCTGGTGGGCGAGCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 56} {0: 1, 1: 0, 2: 11, 3: 97, 4: 1020}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!