ID: 1008030414_1008030423

View in Genome Browser

Spacer: -9

Left Crispr Right Crispr
Crispr ID 1008030414 1008030423
Species Human (GRCh38) Human (GRCh38)
Location 6:46688201-46688223 6:46688215-46688237
Sequence CCCGATGTGATCCCGGTGCAGCT GGTGCAGCTGTGGGGGCTGGTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 74} {0: 1, 1: 0, 2: 11, 3: 117, 4: 1089}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!