ID: 1008042360_1008042365

View in Genome Browser

Spacer: 11

Left Crispr Right Crispr
Crispr ID 1008042360 1008042365
Species Human (GRCh38) Human (GRCh38)
Location 6:46815736-46815758 6:46815770-46815792
Sequence CCTGAGTCCTGACCGTGGGGTTT GATGGATAGTATGATGAAAATGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 1, 4: 92} {0: 1, 1: 0, 2: 1, 3: 19, 4: 247}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!