ID: 1008047277_1008047284

View in Genome Browser

Spacer: 29

Left Crispr Right Crispr
Crispr ID 1008047277 1008047284
Species Human (GRCh38) Human (GRCh38)
Location 6:46864137-46864159 6:46864189-46864211
Sequence CCTTGTCTTAACATAAGATTCTC TATCCTTCCCTGCTGCTGAGGGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 4, 3: 16, 4: 213}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!