ID: 1008070823_1008070832

View in Genome Browser

Spacer: 8

Left Crispr Right Crispr
Crispr ID 1008070823 1008070832
Species Human (GRCh38) Human (GRCh38)
Location 6:47097240-47097262 6:47097271-47097293
Sequence CCCCGTTGGACTGAGACAGTTAA GAACATGCAGGAAGGACGGCGGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!