ID: 1008092798_1008092806

View in Genome Browser

Spacer: 29

Left Crispr Right Crispr
Crispr ID 1008092798 1008092806
Species Human (GRCh38) Human (GRCh38)
Location 6:47309539-47309561 6:47309591-47309613
Sequence CCGGGGCGCGCGGGGCAGCTGGA TCCACCGCCGCCTCCCGGGCCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 24, 4: 261} {0: 1, 1: 1, 2: 2, 3: 30, 4: 346}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!