ID: 1008092798_1008092808

View in Genome Browser

Spacer: 30

Left Crispr Right Crispr
Crispr ID 1008092798 1008092808
Species Human (GRCh38) Human (GRCh38)
Location 6:47309539-47309561 6:47309592-47309614
Sequence CCGGGGCGCGCGGGGCAGCTGGA CCACCGCCGCCTCCCGGGCCGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 24, 4: 261} {0: 1, 1: 0, 2: 9, 3: 86, 4: 594}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!