|
Left Crispr |
Right Crispr |
| Crispr ID |
1008115603 |
1008115607 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
6:47545867-47545889
|
6:47545885-47545907
|
| Sequence |
CCCTACACTTCCCTCTGACAGAG |
CAGAGCCTACCCAAATGAGAAGG |
| Strand |
- |
+ |
| Off-target summary |
No data |
{0: 207, 1: 239, 2: 343, 3: 341, 4: 466} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|