ID: 1008198654_1008198657

View in Genome Browser

Spacer: -4

Left Crispr Right Crispr
Crispr ID 1008198654 1008198657
Species Human (GRCh38) Human (GRCh38)
Location 6:48558536-48558558 6:48558555-48558577
Sequence CCAAGAATAGCTAATGTTTCAGC CAGCTCAAGTTCAAAAGCTGGGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 0, 3: 51, 4: 273} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!