ID: 1008269839_1008269840

View in Genome Browser

Spacer: 17

Left Crispr Right Crispr
Crispr ID 1008269839 1008269840
Species Human (GRCh38) Human (GRCh38)
Location 6:49478316-49478338 6:49478356-49478378
Sequence CCTGCAGTAAATAAATCTATTTC ATCTCCCAAATTGCTATTTCTGG
Strand - +
Off-target summary No data {0: 1, 1: 1, 2: 1, 3: 21, 4: 214}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!