ID: 1008270511_1008270520

View in Genome Browser

Spacer: 17

Left Crispr Right Crispr
Crispr ID 1008270511 1008270520
Species Human (GRCh38) Human (GRCh38)
Location 6:49483706-49483728 6:49483746-49483768
Sequence CCAAGTGTGGGGCCTGCTAAACC ACAGCTGACCTGCAAGCACCGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 21, 3: 139, 4: 510} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!