ID: 1008286625_1008286632

View in Genome Browser

Spacer: 3

Left Crispr Right Crispr
Crispr ID 1008286625 1008286632
Species Human (GRCh38) Human (GRCh38)
Location 6:49660651-49660673 6:49660677-49660699
Sequence CCAGGCAGCTTTCCTGAGCCTTG CCTGGGTTGTAATGACTCCCAGG
Strand - +
Off-target summary {0: 13, 1: 27, 2: 41, 3: 87, 4: 358} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!