ID: 1008288128_1008288132

View in Genome Browser

Spacer: 17

Left Crispr Right Crispr
Crispr ID 1008288128 1008288132
Species Human (GRCh38) Human (GRCh38)
Location 6:49679552-49679574 6:49679592-49679614
Sequence CCCTAATGACTGCACTGGAGTCT CCTTCCATATTCCATGCCTTAGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!