ID: 1008369875_1008369882

View in Genome Browser

Spacer: 21

Left Crispr Right Crispr
Crispr ID 1008369875 1008369882
Species Human (GRCh38) Human (GRCh38)
Location 6:50720007-50720029 6:50720051-50720073
Sequence CCCAAAGCCTCTGAAGTTTATTT GAGCAGCACACAAGGCAAGAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 42, 4: 367} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!