ID: 1008376201_1008376209

View in Genome Browser

Spacer: 11

Left Crispr Right Crispr
Crispr ID 1008376201 1008376209
Species Human (GRCh38) Human (GRCh38)
Location 6:50794953-50794975 6:50794987-50795009
Sequence CCCATAAAAATGTGACCAGCTGG GTCCCCATGGAGCTTTGGAAAGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!