ID: 1008405988_1008405993

View in Genome Browser

Spacer: -4

Left Crispr Right Crispr
Crispr ID 1008405988 1008405993
Species Human (GRCh38) Human (GRCh38)
Location 6:51119177-51119199 6:51119196-51119218
Sequence CCTACTTCCCTTTGGTTCCATTG ATTGCCAGACACATAAGGAAAGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 1, 3: 16, 4: 192}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!