ID: 1008449300_1008449304

View in Genome Browser

Spacer: 12

Left Crispr Right Crispr
Crispr ID 1008449300 1008449304
Species Human (GRCh38) Human (GRCh38)
Location 6:51631755-51631777 6:51631790-51631812
Sequence CCCTCAGTGACTACAAGTCTCCA TAAAAAATGGCATCCACTTCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 9, 4: 154} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!