|
Left Crispr |
Right Crispr |
Crispr ID |
1008482085 |
1008482096 |
Species |
Human (GRCh38) |
Human (GRCh38) |
Location |
6:51996250-51996272
|
6:51996289-51996311
|
Sequence |
CCTCCCGCCTCAGCCTCCCAAAG |
ATGAGCCACCGCTCCCAGTTGGG |
Strand |
- |
+ |
Off-target summary |
{0: 20304, 1: 108143, 2: 164903, 3: 177131, 4: 137557} |
No data |
Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
No off target data available for this pair!
|