|
Left Crispr |
Right Crispr |
| Crispr ID |
1008482094 |
1008482096 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
6:51996267-51996289
|
6:51996289-51996311
|
| Sequence |
CCAAAGTGCTGGGATTACAGGCA |
ATGAGCCACCGCTCCCAGTTGGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 89533, 1: 228199, 2: 240322, 3: 214910, 4: 187714} |
No data |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|