ID: 1008534368_1008534375

View in Genome Browser

Spacer: 13

Left Crispr Right Crispr
Crispr ID 1008534368 1008534375
Species Human (GRCh38) Human (GRCh38)
Location 6:52496045-52496067 6:52496081-52496103
Sequence CCTTATGCTACAGTCATAGCTGG TGTCAGGTTCAGGTGGTGGAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 92} {0: 1, 1: 0, 2: 2, 3: 27, 4: 239}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!