ID: 1008556053_1008556057

View in Genome Browser

Spacer: -3

Left Crispr Right Crispr
Crispr ID 1008556053 1008556057
Species Human (GRCh38) Human (GRCh38)
Location 6:52673586-52673608 6:52673606-52673628
Sequence CCCTGTTTGATCTGGGCATCCTT CTTAGGCTCCCAGTCCTTGCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 14, 4: 145} {0: 1, 1: 0, 2: 1, 3: 17, 4: 124}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!