ID: 1008570246_1008570248

View in Genome Browser

Spacer: 20

Left Crispr Right Crispr
Crispr ID 1008570246 1008570248
Species Human (GRCh38) Human (GRCh38)
Location 6:52809876-52809898 6:52809919-52809941
Sequence CCAGCGTCACAGTCATGAGAGAA TAACCACTGATGCTACAAATAGG
Strand - +
Off-target summary No data {0: 2, 1: 1, 2: 1, 3: 10, 4: 133}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!