ID: 1008578618_1008578624

View in Genome Browser

Spacer: -9

Left Crispr Right Crispr
Crispr ID 1008578618 1008578624
Species Human (GRCh38) Human (GRCh38)
Location 6:52885178-52885200 6:52885192-52885214
Sequence CCATTCTGCCCTGTCCATTGTGG CCATTGTGGTAGTAGAGCTTGGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 0, 3: 7, 4: 103}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!