|
Left Crispr |
Right Crispr |
| Crispr ID |
1008579762 |
1008579769 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
6:52896207-52896229
|
6:52896235-52896257
|
| Sequence |
CCAGGAGCACATGCACTGTAAGG |
CAGGGTGGCCTGAGAGCAGAGGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 3, 1: 1, 2: 3, 3: 6, 4: 143} |
{0: 2, 1: 2, 2: 5, 3: 55, 4: 513} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|