ID: 1008584561_1008584571

View in Genome Browser

Spacer: 25

Left Crispr Right Crispr
Crispr ID 1008584561 1008584571
Species Human (GRCh38) Human (GRCh38)
Location 6:52937025-52937047 6:52937073-52937095
Sequence CCCCACTCTTTTGAGGAACTTCT TGGCTGCATCAGGACCTCCATGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 1, 3: 26, 4: 200} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!