ID: 1008602116_1008602119

View in Genome Browser

Spacer: -5

Left Crispr Right Crispr
Crispr ID 1008602116 1008602119
Species Human (GRCh38) Human (GRCh38)
Location 6:53106578-53106600 6:53106596-53106618
Sequence CCCAGGCTGGAATGCAGTGGCGT GGCGTGGCCTCCTGAGTTGAAGG
Strand - +
Off-target summary {0: 922, 1: 27384, 2: 142895, 3: 248910, 4: 202422} {0: 1, 1: 0, 2: 0, 3: 28, 4: 892}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!