ID: 1008625057_1008625061

View in Genome Browser

Spacer: 9

Left Crispr Right Crispr
Crispr ID 1008625057 1008625061
Species Human (GRCh38) Human (GRCh38)
Location 6:53307244-53307266 6:53307276-53307298
Sequence CCACTTTTGGGTGGTAGTGGTTA ACTTTGGAGCCAGAGAGCCTGGG
Strand - +
Off-target summary No data {0: 1, 1: 4, 2: 40, 3: 224, 4: 1105}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!