ID: 1008660431_1008660435

View in Genome Browser

Spacer: -7

Left Crispr Right Crispr
Crispr ID 1008660431 1008660435
Species Human (GRCh38) Human (GRCh38)
Location 6:53662207-53662229 6:53662223-53662245
Sequence CCATTTTTCCTAAATGACAGCAG ACAGCAGGCTTGGTTCTCCCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 29, 4: 261} {0: 1, 1: 0, 2: 0, 3: 23, 4: 212}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!