ID: 1008660819_1008660823

View in Genome Browser

Spacer: -6

Left Crispr Right Crispr
Crispr ID 1008660819 1008660823
Species Human (GRCh38) Human (GRCh38)
Location 6:53665776-53665798 6:53665793-53665815
Sequence CCACTGGATAAGGCAGGCCGAGC CCGAGCCTGCGCTTTGGCCCGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 9, 4: 95} {0: 1, 1: 0, 2: 0, 3: 9, 4: 147}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!