ID: 1008677493_1008677496

View in Genome Browser

Spacer: 3

Left Crispr Right Crispr
Crispr ID 1008677493 1008677496
Species Human (GRCh38) Human (GRCh38)
Location 6:53835769-53835791 6:53835795-53835817
Sequence CCATAGAATTTTGTACATAATCT CAGTTTTCATGTGTGTTCTGTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 47, 4: 375} {0: 1, 1: 0, 2: 1, 3: 19, 4: 339}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!