ID: 1008705775_1008705782

View in Genome Browser

Spacer: 22

Left Crispr Right Crispr
Crispr ID 1008705775 1008705782
Species Human (GRCh38) Human (GRCh38)
Location 6:54157353-54157375 6:54157398-54157420
Sequence CCCTCTTCACTCTGCTCCTGCAG CCCTCCTTATCCAACTGACCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 5, 3: 61, 4: 551} {0: 1, 1: 0, 2: 2, 3: 8, 4: 113}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!