ID: 1008758808_1008758812

View in Genome Browser

Spacer: 0

Left Crispr Right Crispr
Crispr ID 1008758808 1008758812
Species Human (GRCh38) Human (GRCh38)
Location 6:54829337-54829359 6:54829360-54829382
Sequence CCAGACAATTTATTCAGGCAGTG CATGAGCTCGGATCACCTAGGGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!