ID: 1008801858_1008801860

View in Genome Browser

Spacer: 24

Left Crispr Right Crispr
Crispr ID 1008801858 1008801860
Species Human (GRCh38) Human (GRCh38)
Location 6:55378197-55378219 6:55378244-55378266
Sequence CCAAGATGAAGCACTCTTAGGTT CATTCTATGAAGAATTTTGATGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 102} {0: 1, 1: 1, 2: 1, 3: 53, 4: 637}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!