ID: 1008865482_1008865486

View in Genome Browser

Spacer: -6

Left Crispr Right Crispr
Crispr ID 1008865482 1008865486
Species Human (GRCh38) Human (GRCh38)
Location 6:56204646-56204668 6:56204663-56204685
Sequence CCTCCACAGTGGGTCCCTGACCC TGACCCCCGTGTATCCTGACTGG
Strand - +
Off-target summary {0: 1, 1: 5, 2: 7, 3: 108, 4: 402} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!