ID: 1008865482_1008865493

View in Genome Browser

Spacer: 11

Left Crispr Right Crispr
Crispr ID 1008865482 1008865493
Species Human (GRCh38) Human (GRCh38)
Location 6:56204646-56204668 6:56204680-56204702
Sequence CCTCCACAGTGGGTCCCTGACCC GACTGGGAGATACCTCCAGTAGG
Strand - +
Off-target summary {0: 1, 1: 5, 2: 7, 3: 108, 4: 402} {0: 1, 1: 2, 2: 5, 3: 24, 4: 190}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!