ID: 1008868032_1008868038

View in Genome Browser

Spacer: 18

Left Crispr Right Crispr
Crispr ID 1008868032 1008868038
Species Human (GRCh38) Human (GRCh38)
Location 6:56238657-56238679 6:56238698-56238720
Sequence CCTGCCACCTTCAGCAGATACCT TCCCTCTCCCAAGTACTAGGTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 9, 3: 203, 4: 382} {0: 1, 1: 0, 2: 0, 3: 11, 4: 148}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!