ID: 1008888988_1008888995

View in Genome Browser

Spacer: 9

Left Crispr Right Crispr
Crispr ID 1008888988 1008888995
Species Human (GRCh38) Human (GRCh38)
Location 6:56463588-56463610 6:56463620-56463642
Sequence CCTGTGGGGAGGCCGCCTGCGCA GACACAGAAGTGGATCTGTTGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 4, 3: 11, 4: 117} {0: 1, 1: 0, 2: 0, 3: 20, 4: 242}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!