ID: 1008904482_1008904494

View in Genome Browser

Spacer: 17

Left Crispr Right Crispr
Crispr ID 1008904482 1008904494
Species Human (GRCh38) Human (GRCh38)
Location 6:56661438-56661460 6:56661478-56661500
Sequence CCATCTTCCCTCAAGCTTTACAG CAGTGGCAGCATGCGGGGGGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 26, 4: 268} {0: 1, 1: 1, 2: 2, 3: 25, 4: 292}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!