ID: 1008927027_1008927035

View in Genome Browser

Spacer: 19

Left Crispr Right Crispr
Crispr ID 1008927027 1008927035
Species Human (GRCh38) Human (GRCh38)
Location 6:56897832-56897854 6:56897874-56897896
Sequence CCCTGCTCCCTCCTGACTCACTA ACCCTCAGGCACCATCCTTGTGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 2, 3: 14, 4: 128}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!