ID: 1008952490_1008952497

View in Genome Browser

Spacer: 12

Left Crispr Right Crispr
Crispr ID 1008952490 1008952497
Species Human (GRCh38) Human (GRCh38)
Location 6:57175876-57175898 6:57175911-57175933
Sequence CCAAAGAGGGGGACATGGGAACC CAGTTGGTCAGAAGTTCTGGAGG
Strand - +
Off-target summary No data {0: 16, 1: 29, 2: 95, 3: 185, 4: 443}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!