ID: 1008952494_1008952499

View in Genome Browser

Spacer: 8

Left Crispr Right Crispr
Crispr ID 1008952494 1008952499
Species Human (GRCh38) Human (GRCh38)
Location 6:57175899-57175921 6:57175930-57175952
Sequence CCAATTTGAAGCCAGTTGGTCAG GAGGCCTAGACTTGCAACGGTGG
Strand - +
Off-target summary {0: 3, 1: 33, 2: 95, 3: 192, 4: 396} {0: 1, 1: 1, 2: 2, 3: 6, 4: 44}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!