ID: 1008952496_1008952506

View in Genome Browser

Spacer: 12

Left Crispr Right Crispr
Crispr ID 1008952496 1008952506
Species Human (GRCh38) Human (GRCh38)
Location 6:57175910-57175932 6:57175945-57175967
Sequence CCAGTTGGTCAGAAGTTCTGGAG AACGGTGGAGGGTGGGGTCTTGG
Strand - +
Off-target summary {0: 15, 1: 34, 2: 74, 3: 119, 4: 331} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!