ID: 1008956596_1008956614

View in Genome Browser

Spacer: 28

Left Crispr Right Crispr
Crispr ID 1008956596 1008956614
Species Human (GRCh38) Human (GRCh38)
Location 6:57222311-57222333 6:57222362-57222384
Sequence CCGTGCTTCGTCTGCGCATGCTC CTGTTCTGGCGGGTGGCTGGCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 7, 4: 62} {0: 1, 1: 0, 2: 1, 3: 22, 4: 242}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!