ID: 1008966985_1008966995

View in Genome Browser

Spacer: 20

Left Crispr Right Crispr
Crispr ID 1008966985 1008966995
Species Human (GRCh38) Human (GRCh38)
Location 6:57322627-57322649 6:57322670-57322692
Sequence CCCCAGCCCTGGGGAACTGTGAG TTATGGGTTTACTCAGTCTTGGG
Strand - +
Off-target summary {0: 7, 1: 261, 2: 4036, 3: 9123, 4: 9341} {0: 1, 1: 0, 2: 0, 3: 13, 4: 152}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!