ID: 1008968679_1008968681

View in Genome Browser

Spacer: 4

Left Crispr Right Crispr
Crispr ID 1008968679 1008968681
Species Human (GRCh38) Human (GRCh38)
Location 6:57341178-57341200 6:57341205-57341227
Sequence CCTTCTTGTGTGACTATTTTGAT CTAGTTCAGTGATTCTCAGTGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 16, 4: 248} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!