|
Left Crispr |
Right Crispr |
Crispr ID |
1008985928 |
1008985934 |
Species |
Human (GRCh38) |
Human (GRCh38) |
Location |
6:57543026-57543048
|
6:57543052-57543074
|
Sequence |
CCCCCTGGGCTTCACGCCATTCT |
GCCTCAGCCTCCCGAGTAGCTGG |
Strand |
- |
+ |
Off-target summary |
{0: 2, 1: 337, 2: 432, 3: 637, 4: 1224} |
{0: 94911, 1: 257638, 2: 218586, 3: 135882, 4: 139272} |
Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
No off target data available for this pair!
|