|
Left Crispr |
Right Crispr |
| Crispr ID |
1008985932 |
1008985938 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
6:57543042-57543064
|
6:57543061-57543083
|
| Sequence |
CCATTCTCCTGCCTCAGCCTCCC |
TCCCGAGTAGCTGGGACTACAGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 61556, 1: 45979, 2: 19513, 3: 9543, 4: 8794} |
{0: 54379, 1: 173656, 2: 264604, 3: 194654, 4: 115454} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|