ID: 1009011973_1009011982

View in Genome Browser

Spacer: -9

Left Crispr Right Crispr
Crispr ID 1009011973 1009011982
Species Human (GRCh38) Human (GRCh38)
Location 6:57853908-57853930 6:57853922-57853944
Sequence CCGTCCTTCCCCGAGGGCGAGCG GGGCGAGCGCCGGGCAGGCAGGG
Strand - +
Off-target summary {0: 1, 1: 2, 2: 1, 3: 8, 4: 70} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!