ID: 1009059942_1009059947

View in Genome Browser

Spacer: 24

Left Crispr Right Crispr
Crispr ID 1009059942 1009059947
Species Human (GRCh38) Human (GRCh38)
Location 6:58386951-58386973 6:58386998-58387020
Sequence CCATTGGTGCCTAGATGCGGCCA AGACTGTGGCTCTCACAGAGAGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 0, 3: 1, 4: 50} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!