ID: 1009223407_1009223412

View in Genome Browser

Spacer: -7

Left Crispr Right Crispr
Crispr ID 1009223407 1009223412
Species Human (GRCh38) Human (GRCh38)
Location 6:61003127-61003149 6:61003143-61003165
Sequence CCCCTGTGATATGGTTCATAATA CATAATATGCAGAGGGAAAGAGG
Strand - +
Off-target summary No data {0: 1, 1: 4, 2: 10, 3: 150, 4: 608}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!